nanosight 3 2 software programs (Malvern Panalytical)
Malvern Panalytical is a verified supplier 
Malvern Panalytical manufactures this product 
99
Structured Review
Malvern Panalytical
nanosight 3 2 software programs
Nanosight 3 2 Software Programs, supplied by Malvern Panalytical, used in various techniques. Bioz Stars score: 99/100, based on 11505 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pro+software+programs/NanoSight+Pro/pmc12056760-108-14-18
Average 99 stars, based on 11505 article reviews
Nanosight 3 2 Software Programs, supplied by Malvern Panalytical, used in various techniques. Bioz Stars score: 99/100, based on 11505 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pro+software+programs/NanoSight+Pro/pmc12056760-108-14-18
Average 99 stars, based on 11505 article reviews
nanosight 3 2 software programs - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Software:Article Title: Uracil-Peptide-Pyrene Conjugates as Cu 2+ -Sensitive Probes Targeting DNA, RNA, and Biorelevant Model Membranes. Article Snippet: .. The data processing was conducted by the Article Title: Uracil–Peptide–Pyrene Conjugates as Cu 2+ ‐Sensitive Probes Targeting DNA, RNA, and Biorelevant Model Membranes Article Snippet: .. The data processing was conducted by the Article Title: Impact of polyampholyte macromolecular structure on the conformation of chitosan derivatives. Article Snippet: .. By plotting the apparent zeta potential against the pH, the Article Title: Antimicrobial Effect of Cellulose Nanofibrils (CNFs) and Biobased Additives in Polyvinyl Alcohol Nanocomposite Materials for Sustainable Food Packaging Application. Article Snippet: Zeta potential was performed using zeta-potentiometer (Zetasizer Nano-ZS90, Malvern Instruments, Westborough, MA, USA) at room temperature and a scattering angle of 90◦. .. The Malvern Article Title: A dual-adjuvanted HA stem nanoparticle vaccine elicits a multifunctional antibody response that is associated with protection in newborn monkeys. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotinylated HA A/California/07/2009 DCVC, Duke University N/A FluoSpheres NeutrAvidin (yellow-green fluorescent (505/515)) Thermo Fisher Scientific Cat# F8776 FluoSpheres NeutrAvidin (non-fluorescent) Thermo Fisher Scientific Cat# F8777 Guinea pig complement Cedarlane Cat# CL4051 Veronal buffer with 0.1% gelatin GVB++. .. Boston BioProducts Cat# IBB-300X EDTA Thermo Fisher Scientific Cat# AM9260G BD GolgiPlug BD Biosciences Cat# 555029 BD GolgiStop BD Biosciences Cat# 554724 Zombie Violet Fixable Viability Kit Biolegend Cat# 423113 Penicillin-Streptomycin Gibco Thermo Fisher Scientific Cat# 15140122 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Quick-RNA Viral 96 Kit Zymo Research Cat# R1040 LUNA Universal Probe One-Step RT-qPCR Kit New England BioLabs Cat# E3005S BD Human Inflammatory Cytokine Bead Array (CBA) BD Biosciences Cat# 551811 C-Reactive Protein ELISA (CRP ELISA) ALPCO Diagnostics Cat# 30-9710S Monkey anti-nuclear IgM kit Alpha Diagnostic International Cat# 670-115-ANM Monkey anti-nuclear IgG kit Alpha Diagnostic International Cat# 670-110-ANM Experimental models: Cell lines MDCK-SIAT1-PB1 NIH Vaccine Research Center 59 N/A KHYG-1 MmCD16 Evans laboratory 64 N/A THP-1 ATCC (via Cell Engineering Shared Resource Lab, WFUSM) Cat# TIB-202 Experimental models: Organisms/strains Six-week-old female BALB/c Charles River Laboratories Cat# 028 African Green Monkeys Vervet Research Colony – Wake Forest University School of Medicine N/A Oligonucleotides InfA For1 5 ′ -CAAGACCAATCYTGTCACCTCTGAC-3 ′ CDC designed Integrated DNA Technologies InfA For2 5 ′ -CAAGACCAATYCTGTCACCTYTGAC-3 ′ CDC designed Integrated DNA Technologies InfA Rev1 5 ′ -GCATTYTGGACAAAVCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Rev2 5-′ GCATTTTGGATAAAGCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Probe 5 ′ -/5FAM/TGCAGTCCT/ ZEN/CGCTCACTGGGCACG/3IABkFQ/-3 ′ CDC designed Integrated DNA Technologies Synthetic DNA target sequence: cgactaatacgactcac tatagggagaCAAGACCAATCTTGTCACCTCTGACTA AGGGAATTTTAGGATTTGTGTTCACGCTCACCGTG CCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTA TCCAAAATGCaacatttacagcTCCTCAACTCACTCTTC GAGCGTCTCAATGAAGGACATTCAAAGCCAATTCG AGCAGCTGAAACTGCGGTGGGAGTCTTATCCCAA TTTGGTCAAGAGCACCGCttctatagtgtcacctaaatggatct Integrated DNA Technologies GenBank Accession # MN976418.1, A/Hawaii/66/2019[H1N1], segment 7, matrix gene Software and Article Title: Solid-phase synthesis of high affinity interleukin-6 binders made of gelatin-methacryloyl via a molecular imprinting technique Article Snippet: Collected fractions were concentrated 20 times with Microcon 30 kDa M W.C.O. filters (Millipore, MI, US) at 7000 rpm prior to measurements. .. The material refractive index (RI) was 1.490 and the absorption value 0.01; the dispersant RI was 1.332 for, the viscosity was 0.89 cP as reported by the Article Title: Liquid dispersion compositions, uses and method of making the same Article Snippet: In some implementations, the granular superabsorbent polymer has a specific surface area in the range of about 0.001 m2/kg to about 2000 m2/kg as calculated by Malvern Mastersizer 3000 instrumentation software wherein the specific surface area determination is based on an equivalent sphere model and used for comparative purposes. .. In some implementations, the granular superabsorbent polymer has a specific surface area in the range of about 0.001 m2/kg to about 2000 m2/kg as calculated by Malvern Article Title: IFN-γ-primed MSC extracellular vesicles attenuate rheumatoid arthritis via PD-L1-driven T-cell suppression and bone preservation. Article Snippet: Rheumatoid arthritis (RA) is a progressive autoimmune disorder characterized by aberrant T-cell activation with clinical outcomes often hindered by adverse effects and inadequate remission.. While mesenchymal stem cellderived extracellular vesicles (MSC-EVs) hold promise for the treatment of autoimmune disorders, the mechanisms by which cytokine priming enhances their efficacy remain poorly characterized.. In this study, we investigated the immunomodulatory effects of EVs derived from interferon-gamma (IFN-γ)-primed MSCs (IFN-γ-EVs) in a collagen-induced arthritis (CIA) murine model. Zeta Potential Analyzer:Article Title: Impact of polyampholyte macromolecular structure on the conformation of chitosan derivatives. Article Snippet: .. By plotting the apparent zeta potential against the pH, the Bicinchoninic Acid Protein Assay:Article Title: A dual-adjuvanted HA stem nanoparticle vaccine elicits a multifunctional antibody response that is associated with protection in newborn monkeys. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotinylated HA A/California/07/2009 DCVC, Duke University N/A FluoSpheres NeutrAvidin (yellow-green fluorescent (505/515)) Thermo Fisher Scientific Cat# F8776 FluoSpheres NeutrAvidin (non-fluorescent) Thermo Fisher Scientific Cat# F8777 Guinea pig complement Cedarlane Cat# CL4051 Veronal buffer with 0.1% gelatin GVB++. .. Boston BioProducts Cat# IBB-300X EDTA Thermo Fisher Scientific Cat# AM9260G BD GolgiPlug BD Biosciences Cat# 555029 BD GolgiStop BD Biosciences Cat# 554724 Zombie Violet Fixable Viability Kit Biolegend Cat# 423113 Penicillin-Streptomycin Gibco Thermo Fisher Scientific Cat# 15140122 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Quick-RNA Viral 96 Kit Zymo Research Cat# R1040 LUNA Universal Probe One-Step RT-qPCR Kit New England BioLabs Cat# E3005S BD Human Inflammatory Cytokine Bead Array (CBA) BD Biosciences Cat# 551811 C-Reactive Protein ELISA (CRP ELISA) ALPCO Diagnostics Cat# 30-9710S Monkey anti-nuclear IgM kit Alpha Diagnostic International Cat# 670-115-ANM Monkey anti-nuclear IgG kit Alpha Diagnostic International Cat# 670-110-ANM Experimental models: Cell lines MDCK-SIAT1-PB1 NIH Vaccine Research Center 59 N/A KHYG-1 MmCD16 Evans laboratory 64 N/A THP-1 ATCC (via Cell Engineering Shared Resource Lab, WFUSM) Cat# TIB-202 Experimental models: Organisms/strains Six-week-old female BALB/c Charles River Laboratories Cat# 028 African Green Monkeys Vervet Research Colony – Wake Forest University School of Medicine N/A Oligonucleotides InfA For1 5 ′ -CAAGACCAATCYTGTCACCTCTGAC-3 ′ CDC designed Integrated DNA Technologies InfA For2 5 ′ -CAAGACCAATYCTGTCACCTYTGAC-3 ′ CDC designed Integrated DNA Technologies InfA Rev1 5 ′ -GCATTYTGGACAAAVCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Rev2 5-′ GCATTTTGGATAAAGCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Probe 5 ′ -/5FAM/TGCAGTCCT/ ZEN/CGCTCACTGGGCACG/3IABkFQ/-3 ′ CDC designed Integrated DNA Technologies Synthetic DNA target sequence: cgactaatacgactcac tatagggagaCAAGACCAATCTTGTCACCTCTGACTA AGGGAATTTTAGGATTTGTGTTCACGCTCACCGTG CCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTA TCCAAAATGCaacatttacagcTCCTCAACTCACTCTTC GAGCGTCTCAATGAAGGACATTCAAAGCCAATTCG AGCAGCTGAAACTGCGGTGGGAGTCTTATCCCAA TTTGGTCAAGAGCACCGCttctatagtgtcacctaaatggatct Integrated DNA Technologies GenBank Accession # MN976418.1, A/Hawaii/66/2019[H1N1], segment 7, matrix gene Software and Quantitative RT-PCR:Article Title: A dual-adjuvanted HA stem nanoparticle vaccine elicits a multifunctional antibody response that is associated with protection in newborn monkeys. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotinylated HA A/California/07/2009 DCVC, Duke University N/A FluoSpheres NeutrAvidin (yellow-green fluorescent (505/515)) Thermo Fisher Scientific Cat# F8776 FluoSpheres NeutrAvidin (non-fluorescent) Thermo Fisher Scientific Cat# F8777 Guinea pig complement Cedarlane Cat# CL4051 Veronal buffer with 0.1% gelatin GVB++. .. Boston BioProducts Cat# IBB-300X EDTA Thermo Fisher Scientific Cat# AM9260G BD GolgiPlug BD Biosciences Cat# 555029 BD GolgiStop BD Biosciences Cat# 554724 Zombie Violet Fixable Viability Kit Biolegend Cat# 423113 Penicillin-Streptomycin Gibco Thermo Fisher Scientific Cat# 15140122 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Quick-RNA Viral 96 Kit Zymo Research Cat# R1040 LUNA Universal Probe One-Step RT-qPCR Kit New England BioLabs Cat# E3005S BD Human Inflammatory Cytokine Bead Array (CBA) BD Biosciences Cat# 551811 C-Reactive Protein ELISA (CRP ELISA) ALPCO Diagnostics Cat# 30-9710S Monkey anti-nuclear IgM kit Alpha Diagnostic International Cat# 670-115-ANM Monkey anti-nuclear IgG kit Alpha Diagnostic International Cat# 670-110-ANM Experimental models: Cell lines MDCK-SIAT1-PB1 NIH Vaccine Research Center 59 N/A KHYG-1 MmCD16 Evans laboratory 64 N/A THP-1 ATCC (via Cell Engineering Shared Resource Lab, WFUSM) Cat# TIB-202 Experimental models: Organisms/strains Six-week-old female BALB/c Charles River Laboratories Cat# 028 African Green Monkeys Vervet Research Colony – Wake Forest University School of Medicine N/A Oligonucleotides InfA For1 5 ′ -CAAGACCAATCYTGTCACCTCTGAC-3 ′ CDC designed Integrated DNA Technologies InfA For2 5 ′ -CAAGACCAATYCTGTCACCTYTGAC-3 ′ CDC designed Integrated DNA Technologies InfA Rev1 5 ′ -GCATTYTGGACAAAVCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Rev2 5-′ GCATTTTGGATAAAGCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Probe 5 ′ -/5FAM/TGCAGTCCT/ ZEN/CGCTCACTGGGCACG/3IABkFQ/-3 ′ CDC designed Integrated DNA Technologies Synthetic DNA target sequence: cgactaatacgactcac tatagggagaCAAGACCAATCTTGTCACCTCTGACTA AGGGAATTTTAGGATTTGTGTTCACGCTCACCGTG CCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTA TCCAAAATGCaacatttacagcTCCTCAACTCACTCTTC GAGCGTCTCAATGAAGGACATTCAAAGCCAATTCG AGCAGCTGAAACTGCGGTGGGAGTCTTATCCCAA TTTGGTCAAGAGCACCGCttctatagtgtcacctaaatggatct Integrated DNA Technologies GenBank Accession # MN976418.1, A/Hawaii/66/2019[H1N1], segment 7, matrix gene Software and Crocin Bleaching Assay:Article Title: A dual-adjuvanted HA stem nanoparticle vaccine elicits a multifunctional antibody response that is associated with protection in newborn monkeys. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotinylated HA A/California/07/2009 DCVC, Duke University N/A FluoSpheres NeutrAvidin (yellow-green fluorescent (505/515)) Thermo Fisher Scientific Cat# F8776 FluoSpheres NeutrAvidin (non-fluorescent) Thermo Fisher Scientific Cat# F8777 Guinea pig complement Cedarlane Cat# CL4051 Veronal buffer with 0.1% gelatin GVB++. .. Boston BioProducts Cat# IBB-300X EDTA Thermo Fisher Scientific Cat# AM9260G BD GolgiPlug BD Biosciences Cat# 555029 BD GolgiStop BD Biosciences Cat# 554724 Zombie Violet Fixable Viability Kit Biolegend Cat# 423113 Penicillin-Streptomycin Gibco Thermo Fisher Scientific Cat# 15140122 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Quick-RNA Viral 96 Kit Zymo Research Cat# R1040 LUNA Universal Probe One-Step RT-qPCR Kit New England BioLabs Cat# E3005S BD Human Inflammatory Cytokine Bead Array (CBA) BD Biosciences Cat# 551811 C-Reactive Protein ELISA (CRP ELISA) ALPCO Diagnostics Cat# 30-9710S Monkey anti-nuclear IgM kit Alpha Diagnostic International Cat# 670-115-ANM Monkey anti-nuclear IgG kit Alpha Diagnostic International Cat# 670-110-ANM Experimental models: Cell lines MDCK-SIAT1-PB1 NIH Vaccine Research Center 59 N/A KHYG-1 MmCD16 Evans laboratory 64 N/A THP-1 ATCC (via Cell Engineering Shared Resource Lab, WFUSM) Cat# TIB-202 Experimental models: Organisms/strains Six-week-old female BALB/c Charles River Laboratories Cat# 028 African Green Monkeys Vervet Research Colony – Wake Forest University School of Medicine N/A Oligonucleotides InfA For1 5 ′ -CAAGACCAATCYTGTCACCTCTGAC-3 ′ CDC designed Integrated DNA Technologies InfA For2 5 ′ -CAAGACCAATYCTGTCACCTYTGAC-3 ′ CDC designed Integrated DNA Technologies InfA Rev1 5 ′ -GCATTYTGGACAAAVCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Rev2 5-′ GCATTTTGGATAAAGCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Probe 5 ′ -/5FAM/TGCAGTCCT/ ZEN/CGCTCACTGGGCACG/3IABkFQ/-3 ′ CDC designed Integrated DNA Technologies Synthetic DNA target sequence: cgactaatacgactcac tatagggagaCAAGACCAATCTTGTCACCTCTGACTA AGGGAATTTTAGGATTTGTGTTCACGCTCACCGTG CCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTA TCCAAAATGCaacatttacagcTCCTCAACTCACTCTTC GAGCGTCTCAATGAAGGACATTCAAAGCCAATTCG AGCAGCTGAAACTGCGGTGGGAGTCTTATCCCAA TTTGGTCAAGAGCACCGCttctatagtgtcacctaaatggatct Integrated DNA Technologies GenBank Accession # MN976418.1, A/Hawaii/66/2019[H1N1], segment 7, matrix gene Software and Enzyme-linked Immunosorbent Assay:Article Title: A dual-adjuvanted HA stem nanoparticle vaccine elicits a multifunctional antibody response that is associated with protection in newborn monkeys. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotinylated HA A/California/07/2009 DCVC, Duke University N/A FluoSpheres NeutrAvidin (yellow-green fluorescent (505/515)) Thermo Fisher Scientific Cat# F8776 FluoSpheres NeutrAvidin (non-fluorescent) Thermo Fisher Scientific Cat# F8777 Guinea pig complement Cedarlane Cat# CL4051 Veronal buffer with 0.1% gelatin GVB++. .. Boston BioProducts Cat# IBB-300X EDTA Thermo Fisher Scientific Cat# AM9260G BD GolgiPlug BD Biosciences Cat# 555029 BD GolgiStop BD Biosciences Cat# 554724 Zombie Violet Fixable Viability Kit Biolegend Cat# 423113 Penicillin-Streptomycin Gibco Thermo Fisher Scientific Cat# 15140122 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Quick-RNA Viral 96 Kit Zymo Research Cat# R1040 LUNA Universal Probe One-Step RT-qPCR Kit New England BioLabs Cat# E3005S BD Human Inflammatory Cytokine Bead Array (CBA) BD Biosciences Cat# 551811 C-Reactive Protein ELISA (CRP ELISA) ALPCO Diagnostics Cat# 30-9710S Monkey anti-nuclear IgM kit Alpha Diagnostic International Cat# 670-115-ANM Monkey anti-nuclear IgG kit Alpha Diagnostic International Cat# 670-110-ANM Experimental models: Cell lines MDCK-SIAT1-PB1 NIH Vaccine Research Center 59 N/A KHYG-1 MmCD16 Evans laboratory 64 N/A THP-1 ATCC (via Cell Engineering Shared Resource Lab, WFUSM) Cat# TIB-202 Experimental models: Organisms/strains Six-week-old female BALB/c Charles River Laboratories Cat# 028 African Green Monkeys Vervet Research Colony – Wake Forest University School of Medicine N/A Oligonucleotides InfA For1 5 ′ -CAAGACCAATCYTGTCACCTCTGAC-3 ′ CDC designed Integrated DNA Technologies InfA For2 5 ′ -CAAGACCAATYCTGTCACCTYTGAC-3 ′ CDC designed Integrated DNA Technologies InfA Rev1 5 ′ -GCATTYTGGACAAAVCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Rev2 5-′ GCATTTTGGATAAAGCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Probe 5 ′ -/5FAM/TGCAGTCCT/ ZEN/CGCTCACTGGGCACG/3IABkFQ/-3 ′ CDC designed Integrated DNA Technologies Synthetic DNA target sequence: cgactaatacgactcac tatagggagaCAAGACCAATCTTGTCACCTCTGACTA AGGGAATTTTAGGATTTGTGTTCACGCTCACCGTG CCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTA TCCAAAATGCaacatttacagcTCCTCAACTCACTCTTC GAGCGTCTCAATGAAGGACATTCAAAGCCAATTCG AGCAGCTGAAACTGCGGTGGGAGTCTTATCCCAA TTTGGTCAAGAGCACCGCttctatagtgtcacctaaatggatct Integrated DNA Technologies GenBank Accession # MN976418.1, A/Hawaii/66/2019[H1N1], segment 7, matrix gene Software and Sequencing:Article Title: A dual-adjuvanted HA stem nanoparticle vaccine elicits a multifunctional antibody response that is associated with protection in newborn monkeys. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biotinylated HA A/California/07/2009 DCVC, Duke University N/A FluoSpheres NeutrAvidin (yellow-green fluorescent (505/515)) Thermo Fisher Scientific Cat# F8776 FluoSpheres NeutrAvidin (non-fluorescent) Thermo Fisher Scientific Cat# F8777 Guinea pig complement Cedarlane Cat# CL4051 Veronal buffer with 0.1% gelatin GVB++. .. Boston BioProducts Cat# IBB-300X EDTA Thermo Fisher Scientific Cat# AM9260G BD GolgiPlug BD Biosciences Cat# 555029 BD GolgiStop BD Biosciences Cat# 554724 Zombie Violet Fixable Viability Kit Biolegend Cat# 423113 Penicillin-Streptomycin Gibco Thermo Fisher Scientific Cat# 15140122 Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Quick-RNA Viral 96 Kit Zymo Research Cat# R1040 LUNA Universal Probe One-Step RT-qPCR Kit New England BioLabs Cat# E3005S BD Human Inflammatory Cytokine Bead Array (CBA) BD Biosciences Cat# 551811 C-Reactive Protein ELISA (CRP ELISA) ALPCO Diagnostics Cat# 30-9710S Monkey anti-nuclear IgM kit Alpha Diagnostic International Cat# 670-115-ANM Monkey anti-nuclear IgG kit Alpha Diagnostic International Cat# 670-110-ANM Experimental models: Cell lines MDCK-SIAT1-PB1 NIH Vaccine Research Center 59 N/A KHYG-1 MmCD16 Evans laboratory 64 N/A THP-1 ATCC (via Cell Engineering Shared Resource Lab, WFUSM) Cat# TIB-202 Experimental models: Organisms/strains Six-week-old female BALB/c Charles River Laboratories Cat# 028 African Green Monkeys Vervet Research Colony – Wake Forest University School of Medicine N/A Oligonucleotides InfA For1 5 ′ -CAAGACCAATCYTGTCACCTCTGAC-3 ′ CDC designed Integrated DNA Technologies InfA For2 5 ′ -CAAGACCAATYCTGTCACCTYTGAC-3 ′ CDC designed Integrated DNA Technologies InfA Rev1 5 ′ -GCATTYTGGACAAAVCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Rev2 5-′ GCATTTTGGATAAAGCGTCTACG-3 ′ CDC designed Integrated DNA Technologies InfA Probe 5 ′ -/5FAM/TGCAGTCCT/ ZEN/CGCTCACTGGGCACG/3IABkFQ/-3 ′ CDC designed Integrated DNA Technologies Synthetic DNA target sequence: cgactaatacgactcac tatagggagaCAAGACCAATCTTGTCACCTCTGACTA AGGGAATTTTAGGATTTGTGTTCACGCTCACCGTG CCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTA TCCAAAATGCaacatttacagcTCCTCAACTCACTCTTC GAGCGTCTCAATGAAGGACATTCAAAGCCAATTCG AGCAGCTGAAACTGCGGTGGGAGTCTTATCCCAA TTTGGTCAAGAGCACCGCttctatagtgtcacctaaatggatct Integrated DNA Technologies GenBank Accession # MN976418.1, A/Hawaii/66/2019[H1N1], segment 7, matrix gene Software and Refractive Index:Article Title: Solid-phase synthesis of high affinity interleukin-6 binders made of gelatin-methacryloyl via a molecular imprinting technique Article Snippet: Collected fractions were concentrated 20 times with Microcon 30 kDa M W.C.O. filters (Millipore, MI, US) at 7000 rpm prior to measurements. .. The material refractive index (RI) was 1.490 and the absorption value 0.01; the dispersant RI was 1.332 for, the viscosity was 0.89 cP as reported by the Viscosity:Article Title: Solid-phase synthesis of high affinity interleukin-6 binders made of gelatin-methacryloyl via a molecular imprinting technique Article Snippet: Collected fractions were concentrated 20 times with Microcon 30 kDa M W.C.O. filters (Millipore, MI, US) at 7000 rpm prior to measurements. .. The material refractive index (RI) was 1.490 and the absorption value 0.01; the dispersant RI was 1.332 for, the viscosity was 0.89 cP as reported by the Polymer:Article Title: Liquid dispersion compositions, uses and method of making the same Article Snippet: In some implementations, the granular superabsorbent polymer has a specific surface area in the range of about 0.001 m2/kg to about 2000 m2/kg as calculated by Malvern Mastersizer 3000 instrumentation software wherein the specific surface area determination is based on an equivalent sphere model and used for comparative purposes. .. In some implementations, the granular superabsorbent polymer has a specific surface area in the range of about 0.001 m2/kg to about 2000 m2/kg as calculated by Malvern |